DK945009 |
Clone id |
YMU02A01NGRL0007_O10 |
Library |
YMU02 |
Length |
227 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0007_O10. 5' end sequence. |
Accession |
DK945009 |
Tissue type |
young leaves |
Developmental stage |
sporophyte |
Contig ID |
CL1Contig2 |
Sequence |
GGAAGTCCTGGAAGAAAAGGGGGGCTTACCTACTAAATATCTGACGTGGCAGAAGGGATC TCCCAGAGACAAGAAGGGATGATATATTGGAACGACAAGCAGGGAGGAGAAAGAATTGGG CAAAAATGATGGGCACAAGAAATGGCACAAAAAAAGCTGAACCTCTGTCGGCCGACCCGC CCCTCGCGAAGGTCCCCAGACCACTCGTTAGGCGCGCGGGCCCATTC |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
A7E8B6 |
Definition |
sp|A7E8B6|SLA1_SCLS1 Actin cytoskeleton-regulatory complex protein sla1 OS=Sclerotinia sclerotiorum (strain ATCC 18683 / 1980 / Ss-1) |
Align length |
70 |
Score (bit) |
29.3 |
E-value |
6.5 |
Report |
![](http://dbarchive.biosciencedbc.jp/images/togodb/expand.png) |
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
B2VXE0 |
Definition |
tr|B2VXE0|B2VXE0_PYRTR tRNA (Guanine-N(1)-)-methyltransferase OS=Pyrenophora tritici-repentis (strain Pt-1C-BFP) |
Align length |
44 |
Score (bit) |
34.3 |
E-value |
3.2 |
Report |
![](http://dbarchive.biosciencedbc.jp/images/togodb/expand.png) |