| DK945087 |
| Clone id |
YMU02A01NGRL0008_C22 |
| Library |
YMU02 |
| Length |
184 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0008_C22. 5' end sequence. |
| Accession |
DK945087 |
| Tissue type |
young leaves |
| Developmental stage |
sporophyte |
| Contig ID |
- |
| Sequence |
GCAATGCCTGGTGCAGTTGGAGCTCTTGCCTACTAGATCTTTGACGTGGCTGATCGCATC TCCCAGAAACCCGACTGCATGATGATATTGNAACTGCAATGATCCCACATATAGAATTGT ACAACTACGATGAATATCCCTACTTGCTATACAACCTTGAGATGGCCCTCATGGGCTTTG CTGA |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q32904 |
| Definition |
sp|Q32904|CB23_PEA Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum |
| Align length |
30 |
| Score (bit) |
33.1 |
| E-value |
0.44 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
A0FHB6 |
| Definition |
tr|A0FHB6|A0FHB6_LYCAU Type III chlorophyll a/b-binding protein OS=Lycoris aurea |
| Align length |
40 |
| Score (bit) |
35.4 |
| E-value |
1.5 |
| Report |
 |