| DK945133 | |
| Clone id | YMU02A01NGRL0008_F14 |
| Library | YMU02 |
| Length | 279 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0008_F14. 5' end sequence. |
| Accession | DK945133 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | CL100Contig1 |
| Sequence | AGCCCAAGGTGGAGATGGAGTTGGTTGGTGCTTAAATTTTAGTGCCCGCCTTCTATGAAT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P53585 |
| Definition | sp|P53585|ACLY_CAEEL Probable ATP-citrate synthase OS=Caenorhabditis elegans |
| Align length | 45 |
| Score (bit) | 30.8 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |