| DK945187 | |
| Clone id | YMU02A01NGRL0008_I05 |
| Library | YMU02 |
| Length | 194 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0008_I05. 5' end sequence. |
| Accession | DK945187 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | CL122Contig1 |
| Sequence | TAACTTTGGAACACAAGTTTGAAAAACAATCTTTCTTTTTTTTGATGAACCCTCGCAAGA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q85FH6 |
| Definition | sp|Q85FH6|CCSA_ADICA Cytochrome c biogenesis protein ccsA OS=Adiantum capillus-veneris |
| Align length | 64 |
| Score (bit) | 120.0 |
| E-value | 2.0e-27 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |