DK945187 | |
Clone id | YMU02A01NGRL0008_I05 |
Library | YMU02 |
Length | 194 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0008_I05. 5' end sequence. |
Accession | DK945187 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL122Contig1 |
Sequence | TAACTTTGGAACACAAGTTTGAAAAACAATCTTTCTTTTTTTTGATGAACCCTCGCAAGA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q85FH6 |
Definition | sp|Q85FH6|CCSA_ADICA Cytochrome c biogenesis protein ccsA OS=Adiantum capillus-veneris |
Align length | 64 |
Score (bit) | 120.0 |
E-value | 2.0e-27 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |