| DK945241 | |
| Clone id | YMU02A01NGRL0008_K21 |
| Library | YMU02 |
| Length | 148 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0008_K21. 5' end sequence. |
| Accession | DK945241 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | - |
| Sequence | AAGTCCTGAAATACTGGGAGAGCTTACCTACTTACCAACTAACTTGCTAAAGTGGATCAC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q8NWP2 |
| Definition | sp|Q8NWP2|DING_STAAW Probable ATP-dependent helicase dinG homolog OS=Staphylococcus aureus (strain MW2) |
| Align length | 31 |
| Score (bit) | 28.9 |
| E-value | 8.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |