| DK945348 |
| Clone id |
YMU02A01NGRL0009_A09 |
| Library |
YMU02 |
| Length |
145 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0009_A09. 5' end sequence. |
| Accession |
DK945348 |
| Tissue type |
young leaves |
| Developmental stage |
sporophyte |
| Contig ID |
CL1Contig3 |
| Sequence |
AAAGTTGGAATAAATAAATCCGGGTTTGTCAAGATTATTGAACATCTATTTGGTTGAACG GGATCCCTCGTTTCAACAACTCGGTGAGATATATTTCCCTAAGGGTTTTTTCCTTAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |