| DK945504 | |
| Clone id | YMU02A01NGRL0009_I16 |
| Library | YMU02 |
| Length | 755 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0009_I16. 5' end sequence. |
| Accession | DK945504 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | CL3826Contig1 |
| Sequence | AGTCATATTAACAGCCAACACAGGAATACAGGCCGCGAGCGCGTACTCACTTTTCCACCC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q3EBR3 |
| Definition | tr|Q3EBR3|Q3EBR3_ARATH Uncharacterized protein At2g30942.1 OS=Arabidopsis thaliana |
| Align length | 50 |
| Score (bit) | 60.8 |
| E-value | 8.0e-08 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |