DK945504 | |
Clone id | YMU02A01NGRL0009_I16 |
Library | YMU02 |
Length | 755 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0009_I16. 5' end sequence. |
Accession | DK945504 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL3826Contig1 |
Sequence | AGTCATATTAACAGCCAACACAGGAATACAGGCCGCGAGCGCGTACTCACTTTTCCACCC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q3EBR3 |
Definition | tr|Q3EBR3|Q3EBR3_ARATH Uncharacterized protein At2g30942.1 OS=Arabidopsis thaliana |
Align length | 50 |
Score (bit) | 60.8 |
E-value | 8.0e-08 |
Report | BLASTX 2.2.19 [Nov-02-2008] |