DK945632 | |
Clone id | YMU02A01NGRL0009_P08 |
Library | YMU02 |
Length | 133 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0009_P08. 5' end sequence. |
Accession | DK945632 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | - |
Sequence | TCCCTTCGGGGACATCTGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q8SUR9 |
Definition | sp|Q8SUR9|Z856_ENCCU Zinc finger C2H2 protein ECU08_0560 OS=Encephalitozoon cuniculi |
Align length | 16 |
Score (bit) | 29.3 |
E-value | 6.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9U898 |
Definition | tr|A9U898|A9U898_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 33 |
Score (bit) | 68.9 |
E-value | 1.0e-10 |
Report | BLASTX 2.2.19 [Nov-02-2008] |