| DK945632 | |
| Clone id | YMU02A01NGRL0009_P08 |
| Library | YMU02 |
| Length | 133 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0009_P08. 5' end sequence. |
| Accession | DK945632 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | - |
| Sequence | TCCCTTCGGGGACATCTGATAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q8SUR9 |
| Definition | sp|Q8SUR9|Z856_ENCCU Zinc finger C2H2 protein ECU08_0560 OS=Encephalitozoon cuniculi |
| Align length | 16 |
| Score (bit) | 29.3 |
| E-value | 6.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9U898 |
| Definition | tr|A9U898|A9U898_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 33 |
| Score (bit) | 68.9 |
| E-value | 1.0e-10 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |