DK945764
Clone id YMU02A01NGRL0010_F23
Library
Length 262
Definition Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0010_F23. 5' end sequence.
Accession
Tissue type young leaves
Developmental stage sporophyte
Contig ID -
Sequence
GAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGAACTCATAGATTGCTGGAAA
CTCCTTTCAACATGTGCTACATTGTGCATTGGACAACGGCACTTCATCATGCTCATTGGG
TTTGATCTATATCTTGTGATTTAGAGTATCAACTCATGCCTATGTTTGCTTGTATTGATT
AACATCGTTTAGCTGGTTTCAATTGTATTTTAAAGAACTTTGTAAGGTTGACAGACTATA
ATGATTGTTAGGATGAGCTTAC
■■Homology search results ■■ -
sp_hit_id Q80TI1
Definition sp|Q80TI1|PKHH1_MOUSE Pleckstrin homology domain-containing family H member 1 OS=Mus musculus
Align length 25
Score (bit) 31.6
E-value 1.3
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK945764|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0010_F23, 5'
(222 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q80TI1|PKHH1_MOUSE Pleckstrin homology domain-containing fami... 32 1.3
sp|Q9ULM0|PKHH1_HUMAN Pleckstrin homology domain-containing fami... 32 1.3
sp|Q00IB7|PKHH1_DANRE Pleckstrin homology domain-containing fami... 30 2.8

>sp|Q80TI1|PKHH1_MOUSE Pleckstrin homology domain-containing family
H member 1 OS=Mus musculus GN=Plekhh1 PE=2 SV=2
Length = 1356

Score = 31.6 bits (70), Expect = 1.3
Identities = 11/25 (44%), Positives = 17/25 (68%)
Frame = +3

Query: 3 LIDCWKLLSTCATLCIGQRHFIMLI 77
L+ CW+LL+ CA L + Q HF+ +
Sbjct: 909 LMQCWQLLALCAPLFLPQHHFLWYV 933


>sp|Q9ULM0|PKHH1_HUMAN Pleckstrin homology domain-containing family
H member 1 OS=Homo sapiens GN=PLEKHH1 PE=2 SV=2
Length = 1364

Score = 31.6 bits (70), Expect = 1.3
Identities = 11/25 (44%), Positives = 17/25 (68%)
Frame = +3

Query: 3 LIDCWKLLSTCATLCIGQRHFIMLI 77
L+ CW+LL+ CA L + Q HF+ +
Sbjct: 915 LMQCWQLLALCAPLFLPQHHFLWYV 939


>sp|Q00IB7|PKHH1_DANRE Pleckstrin homology domain-containing family H
member 1 OS=Danio rerio GN=plekhh1 PE=2 SV=1
Length = 1433

Score = 30.4 bits (67), Expect = 2.8
Identities = 11/22 (50%), Positives = 14/22 (63%)
Frame = +3

Query: 3 LIDCWKLLSTCATLCIGQRHFI 68
L CW+LLS C L + Q HF+
Sbjct: 979 LTQCWQLLSLCVALFLPQHHFL 1000


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= DK945764|Adiantum capillus-veneris mRNA, clone:
YMU02A01NGRL0010_F23, 5'
(222 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******