DK946349 | |
Clone id | YMU02A01NGRL0012_F09 |
Library | YMU02 |
Length | 558 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0012_F09. 5' end sequence. |
Accession | DK946349 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL1Contig3 |
Sequence | GAAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGGGTATCGTAGCGGGTATAGTT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P33434 |
Definition | sp|P33434|MMP2_MOUSE 72 kDa type IV collagenase OS=Mus musculus |
Align length | 43 |
Score (bit) | 31.6 |
E-value | 1.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q54CB7 |
Definition | tr|Q54CB7|Q54CB7_DICDI Putative uncharacterized protein OS=Dictyostelium discoideum |
Align length | 55 |
Score (bit) | 32.7 |
E-value | 9.4 |
Report | BLASTX 2.2.19 [Nov-02-2008] |