DK946552 | |
Clone id | YMU02A01NGRL0012_P22 |
Library | YMU02 |
Length | 208 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0012_P22. 5' end sequence. |
Accession | DK946552 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL831Contig1 |
Sequence | ATCATATATCCCTATCGTTTGGTGTGGAAATTGTTTCCCATACTTGGATATACAAGGTTA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A0KL53 |
Definition | sp|A0KL53|HTPG_AERHH Chaperone protein htpG OS=Aeromonas hydrophila subsp. hydrophila (strain ATCC 7966 / NCIB 9240) |
Align length | 36 |
Score (bit) | 31.6 |
E-value | 1.3 |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |