DK946569 | |
Clone id | YMU02A01NGRL0013_A18 |
Library | YMU02 |
Length | 172 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0013_A18. 5' end sequence. |
Accession | DK946569 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL1Contig2 |
Sequence | AAGTCCTGGAAGAAAAGGGGGGCTTACCTACTAAATATCTGACGTGGCAGAAGGGATCTC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q53N99 |
Definition | tr|Q53N99|Q53N99_ORYSJ Os11g0245200 protein OS=Oryza sativa subsp. japonica |
Align length | 29 |
Score (bit) | 35.0 |
E-value | 1.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |