DK946913 |
Clone id |
YMU02A01NGRL0014_C18 |
Library |
YMU02 |
Length |
225 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU02A01NGRL0014_C18. 5' end sequence. |
Accession |
DK946913 |
Tissue type |
young leaves |
Developmental stage |
sporophyte |
Contig ID |
CL223Contig1 |
Sequence |
GACAAAAAAGGTTATGGATACAAGAGATGAAAAACCCAATACAAAAAGTCACCTTTCAAT TTATCATGACCTGCAGTCTGCCAGAATCATTCGCTATTGTTCCATTGGTTTCCAAATGGA TATATAGATTTGAAATTTCAAAGAACAAGGATAAAAAAATATTACACACCGTTACGGCCT ATCCATATAAGATAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q49WB0 |
Definition |
sp|Q49WB0|CDR_STAS1 Coenzyme A disulfide reductase OS=Staphylococcus saprophyticus subsp. saprophyticus (strain ATCC 15305 / DSM 20229) |
Align length |
26 |
Score (bit) |
29.3 |
E-value |
6.5 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|