| DK947888 | |
| Clone id | YMU02A02NGRM0001_B12 |
| Library | YMU02 |
| Length | 162 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU02A02NGRM0001_B12. 5' end sequence. |
| Accession | DK947888 |
| Tissue type | young leaves |
| Developmental stage | sporophyte |
| Contig ID | CL1Contig2 |
| Sequence | GAGGAGAGTGATGAGGGCTTCGTTTTACTAGGCGAAACAGTTGAGTGCTGCACCCCAAAT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7R8H6 |
| Definition | tr|A7R8H6|A7R8H6_VITVI Chromosome undetermined scaffold_2564, whole genome shotgun sequence (Fragment) OS=Vitis vinifera |
| Align length | 40 |
| Score (bit) | 44.7 |
| E-value | 0.002 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |