DK947888 | |
Clone id | YMU02A02NGRM0001_B12 |
Library | YMU02 |
Length | 162 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU02A02NGRM0001_B12. 5' end sequence. |
Accession | DK947888 |
Tissue type | young leaves |
Developmental stage | sporophyte |
Contig ID | CL1Contig2 |
Sequence | GAGGAGAGTGATGAGGGCTTCGTTTTACTAGGCGAAACAGTTGAGTGCTGCACCCCAAAT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7R8H6 |
Definition | tr|A7R8H6|A7R8H6_VITVI Chromosome undetermined scaffold_2564, whole genome shotgun sequence (Fragment) OS=Vitis vinifera |
Align length | 40 |
Score (bit) | 44.7 |
E-value | 0.002 |
Report | BLASTX 2.2.19 [Nov-02-2008] |