CL1070Contig1
Contig ID CL1070Contig1
Length 797
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1070contig1 sequence.
Clone ID BP917310 BP918146 BP920390
Sequence
TGTGGAATTTGTGGATACCAGCTGACAGTGCAGCTTTGGCATCTAAAGTTTTGGCTGTTG
AGGAAATAAAGTCACAGTCTGCAAACAACAAGGACTGGCTTCTTGGTGCGAGTTTGTCAA
ACCTCGAATATGCACATCTTTGTGAAATTATGGGACGTTCAATGCTTGCGCCTCAAGTTT
TCAATTGCAGTGCTCCTGATACTGGCAACATGGAGGTTTTGTTAAGATATGGCAGTCCAC
AACAACAAAGAAAGTGGCTCAAGCCTCTATTGGAAGGTACTATCCGATCTGGTTTTGCAA
TGACTGAACCAGATGTTGCGTCGTCTGATGCAACTAATATTTCGTCCTCAATCATAAGGG
AAGGAAGTACTTATGTTGTTAATGGTCGTAAATAGTGGACTAGTGGGGCAATGGATCCAA
GATGCAAAGTGCTCGATTGTCATGGGGAAATCTGATCTGAATGCTGCTCTGCACAAGCAA
CAATCTATGATTCTGGTAGAAATGGATGCTCCTAGGGGTTCGCATTGTACGGCCATTAAC
TGTGTTTGGATATGATGATGCTCCCCATGGGCATGCAGAAATTGTCTTTGAAAATGTGCG
TGTACCAGCAGACAATCTTCTTTTGGGTGAAGACTGTGGATCTTGAGATTGCTCAGGGTA
GATTAGGCCCAGGAAGGCTCCATCATTGCATGCGCCTGGTGGGTGCTGCAGAGCGTGGGA
TTGATTTGATGAGAAATCGAGCACTAGAAAGGGTTGCCTTTAAAAGACCCTTGGCATATC
ATGGAGCTTTTACATCG