CL1116Contig1
Contig ID CL1116Contig1
Length 757
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1116contig1 sequence.
Clone ID DK950957 DK960458 DK963211
Sequence
ACGAGGTACGCACACCTCTTCCCTTTCTCTCTCTATCTCTGTGTGTATCGCCTGCTCAAC
CCCGTGCCCTGCAGCAGAAAGGCTGCGCGCTGAAACCCTTCCGAGGAGTTCTGCTACCTT
CTACCTTGAACTGGAGCCATGAGCGTTGCTCCGGGTATCGTTGAGCGCAATGGTCATCTC
GACGCGCACATCGCTCAGCTCATGCAATGCAAGCCTCTGCTGGAGCCCGAGGTCAGATCT
TTGTGTGAGAAAGCCAAAGAAATTTTGATGGAGGAAAATAATGTTCAGCCGGTCAAATGT
CCAGTCACAATTTGCGGTGATATTCACGGGCAATTTCACGATCTTGCCGAGCTTTTTCGG
ATTGGTGGGAAGTGTCCGGATACAAACTATCTATTCATGGGAGATTATGTGGATCGTGGA
TACTACTCGGTCGAAACTGCTACTCTTCTGGTGGCTTTGAAGGTTAGATATCCTGATAGA
ATCACAATTCTCAGAGGCAATCATGAAAGTCGTCAGATTACACAAGTGTATGGCTTTTAC
GATGAATGCCTCAGGAAGTACGGTAATGCGAATGTCTGGAAGATTTTCACGGATCTTTTT
GACTATTTTCCTCTAACTGCTTTAGTTGAGTCCGAGATATTTTGTCTGCATGGTGGTTTG
TCACCTTCTATAGATACTCTCGATCATGTGAGGAAACTTGAGCGTGTACAAGAAGTACCC
CATGAAGGGCCTATGTGTGATCTACTGTGGTCAGACC