CL1150Contig1
Contig ID CL1150Contig1
Length 951
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1150contig1 sequence.
Clone ID BP914034 BP913992 DK955759
Sequence
GACAGTTTTCAGCCCTAGCATTTTTGCATCAGCATTACCTCCTAGCGTTTTGCAGATTCA
TCGCGACAAGATTATCCCTTGCACCAGTGTTTTCAGTTTTCAGCAGTAGATCCCACAATA
GACCCCCGAACCTCGTAGATCTCACCTTCCCGTAGCAGATCCTTGCCACACAATCCGATC
CATCGGAATTTGCAGTTTCAGCCTGGAAAACGCAGATTTCAGCATCTGCGTTTTCAGCGC
GTCGTCATCGCATCGTCGCCATCGACATCGTCACCGACATAGAGTCAGAATTCAGCAGAT
AAAGATTTGCAGATTTCAGTCATTAGCATTTTCAGATTTCAGCCCGTCTCGTCATCGTCC
TTATCGTCGTCGACATCGTCGGCAAGTCCAAGCATTGTACAGATTTGTGCAATCAATAGT
AGAACGCTCTCGCCATAGAGAGTGGGGGCTTCGGAGGAGGGTTTGACAGCCTCTCTGGTG
TCTTATGCTCTTCTCTCTCTATCTCTTAGTCTCATACACTTCCATTCACAGTGTCCATTC
ACTTTGTTTGTGTCCATTGCACTCTCTCATTAAGAACGGAAGGCTCTTCCTTCCATAAGA
AAAGAAACCTTGAGCACAGTTCGGAGCACTCATCTTGAGCAAAGTTCAAACATTCATTCC
GCTGCACCTTACATTGGTATCAGAGCTTTAGCAGTGTTCTGTATCACTCAAGGAAAGAAC
CACAAGAATCACAAGAATTTATTTATTTTTTTGATTGTTGAGGTCGCACGAACCCAAGTT
CACTTGGGCGTGTCGATTCCTAATTGTGTTTCTGAAGAGTGACAGGAAACCCAAGAAAGA
AGGGCTTGTGTAGTCTCCCCTTGTGCCTCTTTTCACTCATTGAGAGCGGATTGTGCACTT
AGCGGCCGGCCAATCGACGTGAATTAGGAAAAAGCAACCTTGGCGTGAGCG