CL1256Contig1
Contig ID CL1256Contig1
Length 568
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1256contig1 sequence.
Clone ID BP916542 BP920857 BP919336
Sequence
GACGACGGAGATGATCTCAGACTCTATTGATGATGCTCTGGATAATGAAGAAGCCGAGGA
AGAGACAGAGGAGTTGACTAATCAGGTGCTGGATGAGATTGGCATCGATATTGCTGCCCA
GCTCTCATCAGCTCCAAAGGGAAAAAGTGCAAACAAGAGAGCTCAAGGCACAAGCTCTGA
GGTGGACGATTTGGAACAACGGTTGGCAGCACTGCGAAATGTTTAAGTGCATAACTCTGA
TATGCAAATGGAATCATACAAGAGGACATTCACATCAGCAAACATGCTTTGTGTCGTATT
AAAACGCGATTGGGTCTTTGTTATTGACGCATGCTCCATTCACATCAGGATGTGGAGGTG
GGATTCTCAGTCTGGCAAGAGTTTTGTATACATATGGACACTGCTATTCATTTATTTGTA
ATGATAATACCTACAGCGAGCAATCAGGTAAAGAGGGTTTCAAGAAAGATTGTTTTCTCG
TTCAACCAGAAGATCAACCACTATAATGTTGTGGGTACACTTGGTTGACAGTTTACACTG
GCCTTATGCTATGTTCAGTTGAGCCATT