CL1258Contig1
Contig ID CL1258Contig1
Length 957
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1258contig1 sequence.
Clone ID DK947359 BP913710 DK952028
Sequence
CTCCAGAAAAGGCACGTAAGGCCACCAAAGGATTACCATCAACTGAATACATAAAGATCA
CTAGGTTCATGTTATACCAAATGCAGCTCAACAAGAGAATTTGGAACCTCGTAAGTGTCC
TACTATGATGCTAATCAGCACATCATATCGGCCCTCATGACCCAATGTTCACCAAGAGCT
CTTGTACATTCCAATATACGAGTTGCATACAACCATGACTCGTCACCACACGACCTTTAA
TTAAACAAGTGGATATAAACACACATTCCAAGAATCTCACCAGGATGAAGTTTTCTCACT
GACAATAATCAGACAAAACCGCCAAAATCTTCACCCAGGGATCTCACAGAATGGACATTC
TGATCAACTCCTTCCATGAAACATACCATGTGGCACTGTCATGTGCCATTGAATCTGCTA
AAGAAGATAAGTCGAGCTCAAAGGAAGAGAACTTGGAAGTGTTGAAAAAGGTCACATAGC
ATCCCGTGCTGCAATGCGACATGCCACTGCATCTTTTGTATTAGTGGCTTATCTGATCTT
TTTTCAAGCTCCTCTAGGTCAATTTCCTTGCCCTTGACTAGACCTCTTGCAGCCTCCAGC
TCTGCAACTGTTGCATTGAACCTTGCAACCAGAACATAGGTTGAGCTTTCATTCAAACCA
CATCTTCTTAGTGATTCTGTTATATGTTTTGATCCAGAAAAGTTGTATATCAGTTCAGAA
TGGAGAGTACGAGTGACCAAGGTACTCTGACTTAAAGCTAGCACCGTTTTATGCGCTGCA
ACTAGCAAAGGGAACAAATCTGGAACCAAAGAAGCATTGAACAAGGCCAAATCTGGCTCA
AGAGACCCTGTTTGGACAGCCTGCAAGAGCTCCCTGCTGTTAGTGACATCGCTGAAGAGA
AGCACGGCGAGACTCTGGCCCGGCTGTGTATCAATTTCAAAAATCGCCATTTCTCAG