CL1387Contig1
Contig ID CL1387Contig1
Length 566
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1387contig1 sequence.
Clone ID BP917664 BP917450 BP920523
Sequence
CGTGGATTCTCATGCTAACGACGGAAACAGACGCCATTAGGTTGTTCTTTGACTCCAGGG
ATTGAAGCACGGCCGTGCCTAATGTACAAACACTGTTGAGTAGTTTCAAACTTGTATAGA
TCGAAGAGATGCCAAAGCAAACAGATTTTGCTTCTGCAAACCACGTCATTGGGCACGTAA
GGGAGGAAGAAGCTGTATGGTTACCCAAGAACCTCTCGTTCAAGTACATAAGGGAGAAAG
ATATTGCTTTACCCAAGAACCCCTCATAAGGGAGAAAGATGTCATATGGTGCTATACCAA
GCACCTCTCATTCAAGTACAAGATGGGGTCTTGTGCCACATTACAACTTAACAAGAGAGC
ATAGAATTATGGAGGAGCTTATTAAGCCCAGGCTGGATAATCCTTGACCATTTTCACTAT
TGGAAGAAGCATGATTCAATTTTGGTTATGTAAATAGACATTCACGGAGAATTGAGGACT
GCGATGCTGATTTTCGTTTTCCTAGGGAACGATGATATTGGCCTTTATAAAATACGCATT
ACTCTGGAATACATAATACACATTTT