CL1756Contig1
Contig ID CL1756Contig1
Length 815
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1756contig1 sequence.
Clone ID BP917762 DK951899 DK957128
Sequence
CTGGCGGGGTTGAATACGCACGTAAAATGAAAAATGGCTGCTGCAAAAAGAAAGCTTACC
AGCCACCACAGAAACTCTGCAACAATTCGATTCAACGGGTAGAAAACTAGGTACACGAAG
AGGACGATGGAGAGGAAGGCGCCCACCAGGAAGAAAACGAAAACAAAAGCCCACAGGAAA
GTGATGAGGAGGCGACGCCATACCTTGGGCAAAACACAGAGAACCTTCCTGAAAGTGAGT
GGACGCTTGGTGTAGATGCATGCAACACTGTAGACAGTAGCCGCGGTTGACAGAAGGGCG
AAGGCGAGGACAAGCAAAACATAGGCAGCCAAGAGAAGACCCAGGCGGATGCGATCAGCT
GTGATGCGGCTGCGCAGGGATGAATCTACAACAGGATTCTCTTCATATCTGCGTATGCGC
GAGACAAGAGGATCTATGGCCAGGTAGTGCGCCAGAATGATGAAACAGAGAGGGAGCGTG
AGGGTGAGAGCGATGGCGGCAAAGAGCTTCGCACGTGTGCAAAGCACGGAGATGGATTGC
CTCACCACTCCACAAATCCCCAAATCCTGAACGTTTCCCCAGCCTGCCGCTCCAGGGGAG
CTCTCCATGCCCTCAATTCGCTGAGAAAGCCCTTGATATAGCAGCTGTCCCGGGATAATT
TGAGTTGGGTGCGATCTTCTGATGCACCAGCTATGGCGAGCACCGAAGAGCTACCCTACG
GCAGCTGAGAGGCAGGGATTCTCTGCTCTGCCGAGATGAAGCTATGGAAAGCTTGAAAAC
TTTCCACTTTACCACCTTCTGTGCGTGTTTGTGGG