CL1885Contig1
Contig ID CL1885Contig1
Length 690
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1885contig1 sequence.
Clone ID BP915564 DK946111
Sequence
AATCAAGGACCCTGTCTTTGTGCAAATTGGTATAGACAAGCTGCTGAAAGATGCTGAAGG
GCTTGTGGGTTGACATATTTTATGACTCTATAGTAGAAATGTCATCTAGGGACTGCATGA
TGTCTTTGTATGATCCAGCAAGTTTTGAAGCATCACCACGAGGCAAGGGACTACAGTGGC
AGAAAATGTACTTGTATGATAGGGTCCCTCATCTGCTTGCTAAAGTAAATGGGAGGGAAG
TACTGCTGATGCTGGACACAGGCGCTGCAGGTCCAGGATTAATGTTTCCGAGCAGTGCTG
TACAAGGTTTTGATGATCAGCAAACAGCAGACATGCCAGCAACACTAGGAAGAGGGAGGA
CACTCTATTTCTCTCAAGCGGATTATGGAAATGTTCAAACTTTTGAAATTGGTGGTTGCG
TGTTCAAGGATTTGACAGCCATGGTTCTGAATAAAACTGGGCAGCAAATGGGGCTTTCAG
GATATAGTGCTGGGGTGGTTTGTGCCGAAATGCTGAGACACTTCAATGTGGTATTGGATT
ATGCAAATGGTCGCATGGCTTTCGTAGATCAGAGATTCAGGAGGAGACCGTCAAGATATT
AAATTAATGGCCAGCTGTGATTCTTGCATATTGATGTAGTAATGGAAGGCCCCTCTTGTT
TAATGTTTATAGTAGGGGCCTGTATCTTCG