CL1965Contig1
Contig ID CL1965Contig1
Length 724
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1965contig1 sequence.
Clone ID BP915078 BP918156
Sequence
ATTACCATTAAGTGGCTGGTTTTGAAGGACTGCTTTCAAGTAGCTTCTGTGAATCCATCT
GGCATCCTCAAGCTCCTTTGTGTCAACTGCAATTGTAGGAAGTTTTGTGTTCTCCATTAA
CACACGGAGTCCCTCGTTGCCGACTGGTACAACATCATCGACGAACTTAGGAAAGCTTAA
TTGTTTCTCTTCAGCCTCAGCCATGAACCCCACCATTAGTGATTGAGGAAATGGCCAAAG
CTGGCTCGCAATATACCTCAATCCGTCAAGTTTCACTTTTATTCCAGACTCTTCTTGTAT
CTCCCTTGCAGCCGCTGTTTCAAAAGTCTCTCCAACCTCTACAAATCCTGCCAATAAGGA
ATATCGGCCTGGCTTCCATCTGCTCTGTCTGCCCAGAAGAAGATATTCTCCACAAGTGAC
AAGCACTATGACTGCTGGATCCAGACGAGGATATATAGAACTTCCACACTCTCTAAAGGA
GCACTGTAAGCTATGGCCACCTTCCTTGAACTCCATTTCTCCACCGCAACAGGAACAAAA
TCTATTTCTCATGTGCCATTCCACCAATCCCCTAGCATAGGCTAGAAGTCCAGCATCATT
ACTCTTCAATTCTGATGCATAGCTTCGAAGGTCAACCCACTCACATCCTTCTGGCCACAA
CTCTGAACTCAAATGTTCTCTGCAGACACTACTGACCTCCACTGCAAACAATGGTTCATT
GCTC