CL2081Contig1
Contig ID CL2081Contig1
Length 507
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2081contig1 sequence.
Clone ID BP915242 BP920809
Sequence
CTCGCTATGCTGACGTCCGTCGCGGGGTATCCGTTCAACATTGGTGCCGCTGTCGGGGAC
GAAAACCTTAGGTAGGTGACCGAGACTAGTCCTTGAGGATAGGAATTCTTTGGCTTTCCA
AGAGTCTCGTTTTACATTTAGATAGGATCAGAGGGTGGAGGACTCTCCAGGTCTTAGAGG
GAGTCTAGGGAGCGTGTGTTTGGCCTATATCCTTTGACTTAGGTAGACTTAGGTACTTTT
TAGTTAAGTTGTGGTGTAGAGAGTAGGAGTTGGAGTGGTAGAAACGGTGAGAGGAAAGCT
TGACAGGCCAGGAAGCAACCAAAACACCATTATCACCATTTCACATGAGGAGTAGGAGTA
GAGTAAGTAGGACATCATGATTCAGAATCTAGAGCACTTCATGCATGTATACTTGCTTGT
TAGATTCATGACGAGGTTGTAAAAGACGCAAAAGTGTGTTTGAAAGCTGAAGTGAAGTCC
AAAAGTTATCGTGAGTGCTTCTGATAG