CL2297Contig1
Contig ID CL2297Contig1
Length 874
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2297contig1 sequence.
Clone ID BP916656 BP920685
Sequence
CCAGACCTCAGATTCATTCGTAGCTGCAGTGCATCTCTTGCCCCTGCTGTTCTCCAACAG
TTAGAAGAAGCATTCAGGGCTCCCGTTTTAGAAGCATATGCAATGACAGAAGCCAGCCAT
CAAATGACTTCTAACCCTATACCTCAACATGGCCCTCGCAAACCTGGCTGTGTTGGTAAA
CCCACAGGCATTAAGCTTGCTATCCTGGATGATGAGGGAAGAGAGTTGCCACCTGGACAA
GTAGGAGAAGTTTGTATCAAGGGACTGAATGTAACCAAGGGGTATAAAAACAATGCGGAT
GCTAACAAAGTGGCATTTGCATTTGGGTGGTTTCACACCGGAGATAGGGGGTTTTTAGAT
GAGGATGGTTACTTGAGCTTGACTGGTCGAATCAAGGAGTTGATTAATCGTGGAGGAGAA
AAGATTTCACCTTTGGAAGTTGATGCTGTCCTTCTTGCTCATCCAGCTGTGGCACAAGCT
GTCACCTTCGCAGCACCTGACAGTAAATACGGCGAAGAAGTAAATGCTGCCATTGTATTC
TCAGAAGGGGCGTACGTAACTGAGGAGGAGATCAAGGAGTTTGGCAAGAAAAACCTTGCA
ACTTTTAAAATTCCTAAAAAGATATTTTGTGCTAAGGACGTGCCTAGAACTCCAACTGGG
AAGATCCAAATGAAGAATTGTTGCCGCAGCATTTTTTATCCAACAAGTCATCGTAAAGGT
GTTTGCTTCTAGCTCAACCAATTCCAATTCACTGCACTTCACTGAGAATGTTTCCCGCCA
ATAAGAAATGCTTTACATCAACAAGGAGCAATAAGCATGGGTATCTTGTAAGAATTACGT
TTTCTTTACCTAAGGCAAGGATGAGGGTGATACA