CL2435Contig1
Contig ID CL2435Contig1
Length 521
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2435contig1 sequence.
Clone ID BP915235 BP920356
Sequence
CCAAGCCACTCACAGCTTTCAGTTTAAAACACACTGCAGTGCAAGAGGAGGGTCTTGAAC
CAATTGCTCAAGGGTTTTCGAAGTCGAGGCTCCCTGTTCTTCTTCAAGCTAGGAGTTTCA
AGGTTTCCATATAGCCCTCCAATCTATGGGATGCTTGCAGTAACAATCTACTTCCGTAAA
AAATATGGCCCCATATTCAACCTTTATCTCAGAAGTTCAGCCTACCCTCTTGCCTATTAG
TGACAGCCGTATAAGTCACCCAGAGAGACATAAGCAGCATCAACTTCACCATATTCTTGC
ACTGCATATCCAAAGGCCCACCTTCCAAGCTTCGTATCCCCACGAAAGCGACAAGCACCA
AGAAACGTATGCCATACTGTGCCATCAGCAGAAAATGGCATTTCCTCGATCATTGCTACC
ACCGTCTCCAAATGCCCAATGCGTCCAAGAAGATCTATCATGCAAGCATGGTGTTCTAAA
GTGGGAATTCTGCCATGGACTTTGCTTATCATTCCAAAATA