CL2496Contig1
Contig ID CL2496Contig1
Length 853
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2496contig1 sequence.
Clone ID BP912216 BP917060
Sequence
TACTTTAGCCCATGGTAAAAGGTAAGTCTCCTGTCATTGGCACCAATGCTTCCATCATTG
ATGCGCCCCAAGCGCAGTTGTGCATGCACAATAGTGTTGTCGATAGTGAAGAGTTGCTAA
TCACCTGTCTTGTACTCATATATCTCCACAGGAAAACAGTTGAAAAGAGTCCCTTTGATC
CCACTTGTTAAGAGAAATTTTGCTTTCCTTTATAGCACTCCATTGTATGTGTATGTACAT
TGTTTCTAGCGTGCAGAATATAATTGACACAAAGAACCCTTCGTGTGCCGTTGCCATTGT
CTCCCTGGTCCCCGCTTTCAACTCTGTACATCGTCGTCCTGAAGCTCCCCTATCGTATGC
CCTGTGAGTGTACAAGAGATGCCCTTATATAGGCATTGGGGAGAGAATGGTGTGGGTGAT
GAGGACGGGTCTTATTTTACAATTTCAAGGCAATGATGCAAACACCTAATCCTAGGACCA
CTCTCCCCAAGTCTGCACAAGTGAGGGATATACTGTGCAGCCTACTTTCTGCTTCTAGCC
ATCTCAAATTTGCTATGCACTCGCCTCCCGATGGCTCAGCTTCAACGAATTCACTCGGCT
TGACTTATGGCCTGCCAAAGGCGATGGAGTACGTTGCGGTGGCCGCAAAGGGCTACTTGA
AGCTGAGCATAGATGAAATGAGCCATCCTGCAATTTTGGCTCTTCCATACTTATATTAAT
GTGAGATAGAGACCTTCCTCCAGTCTGCCAACGGCCTGTGGACAAACTCGATGTAGGAGG
CGACTCATCGCCGATGACAAGAACATTGGTAGGATACTGCAAGCCTTGTCTCATGTGGAG
ACACTTATCAGAG