CL2505Contig1
Contig ID CL2505Contig1
Length 1002
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2505contig1 sequence.
Clone ID BP917654 DK959328
Sequence
TGATCCATAAAGCGTGTGTCAGGTCTGCCAAGAGCTGTTTTATTTTACAGAACATAGCAG
ACTTGACACCATAAAATAGACTCTACAAGATAGTATACAAGCGCACACACACCTGTGTGG
ATCAAAATACTCCAGTTCTCCAACATACTTTGCCGGATCGTTGGTCAAGATGTGTAGAAT
AGATCATGTCAGTAGAGTAAGATGGTCTTACCATCAAACAATCCAAAAAAAGACCACCCT
TCCAAAAAGAGCAATCTACTTCCTGAATACCAAACTCGAAATCGACATCAACAACATTGC
GCCCTTCTCCCTTGACATCAATTTGACCAACTTCAAATTCGAACCATTTCTCATACCCTT
TGTTTGGCAGGCGAAGCAAGTCCAAGTCCTTCTCTGAAAGTGTGCCCAAGTGCGATATGA
AGAATTTGAGAGGCCGCAACCACATGAGGAAGTGCCCTTGTCCACCTTGAGGATTGACAA
CCTTAAGATGCCAGCACACAGAGTACTTTCCTGGAGGGAGAGTGCACTTCCACCTCCCTT
TAACTTCAAGCCAGCATACAGCTACCAAGTGTGCTACCTTTGGGAAAATTGACCTTCTTG
AGGGTTCCCAACGCCAGAACCTCGGATCATCCTTCCAGGCAATGTTCATGGCAGAAACAG
ACATGAATCTGCAAACACCGCCGGAACGTTTGAGAAGCAGGTACCCTTGGCTGCCGCTAA
CGAGAATGATGGCATGGGTGAGCCATTGAAAGACTTCCCTCTTGTCCGTTGCATTCCAAA
GACGACTAGGGTTCAAAGAAGGCGGCCTGCTGCAGCGAAGGATGTGTGTACAGTCGGATG
GCAGGACATTCTGCCAGGTGACATTCGAGCGTGCAGCTTGCGCGAAGGAGCGGCTTACAG
TTGCGAGCCTGCAGACGTCAAGAGGCGAGGTCCATGAGAGGATGAGGCAGAGGCAGTCCT
CCGGCAACCTGTCCAAGCTGCCCATCTCATGCAACATTTTCT