CL2526Contig1
Contig ID CL2526Contig1
Length 756
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2526contig1 sequence.
Clone ID BP918958 BP921533
Sequence
TTGTGTTTTCCTCAACTTGTCACTTAGAAAGGTCATACGGTATCTGCTTTGAGTGTAAGT
GAGAATCTAAGGCAAACACTATGGACGTGTACATGCAATTTCTTTGAATGAATTGCAAAG
CCTATGGATAGATATCCATGCACATAGTTAGTTTAATCATCAGTCAATTCCTTATTCCTA
CACAACAAGAATCATGGAGAAGCTCAATGGTGTATTAAATATTACATTATGCCTTGCTAC
TCACATGCATGCACCCACCACTTTATCAACTCTAATTTTGGCACTAGCCGCTAGGTCAAC
AAGAGTCAAGGCAACAATAGAGATGATGGCCTGTCTCATCTTCATTTTTTGCTTGGTCCC
TCGTTGACTCTTTTTCAACCTGTATTAACCTATTTGTGTAGCTTCCTTTGACAGCATAAT
TATTGCAAAGGTGTTCTTTTCCCTTTTTAACCTCCAGTGATCTGGGCAACTGGCATTGTT
GCTACAGAGACTGGTTAGCTGTATCCGAGTTATCTTTTGGCATTTGAAGTGTGTGGCGAA
GTTTGCCTATGGAGGTTCCGTAACAATTGCAGGTTCAACCCCGTCATTCTCCTTTTCGTT
GCTCAGCTTTCACGCCACCATGTTCTACATATCTTTCCGTCATTTTGCTTCAGCTGATCG
TCCATCTTTTCCTAGTATGCTTCCTTTAGACTTCAGCATACATGTACTTTGCATAGCCAA
TTGCGCAGATGAGGACCAATTCTTCAGACTCCATAC