CL2574Contig1
Contig ID CL2574Contig1
Length 767
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2574contig1 sequence.
Clone ID BP917911 BP920140
Sequence
GAAGAAATTGAGTAAGCAGCTGAATGGGGAAGAGTGGTCTTGGAACAATTTAAACACACT
TTGCTGGGCAATTGGTTCTATCTCAGGATCTATGGCTGAAGATCAGGAAAATCGATTTCT
CGTCTCAGTCATACGTGACCTCCTGAACTTGCGTGAGATTACAAAAGGAAAGGACAACAA
AGCTGTTATAGCAAGCAATATAATGTACGTCGTCGGACAATATCCAAGGTTTTTGAGAGC
GCACTGGAAGTTTCTGAAGACAGTTGTCAATAAGCTGTTTGAGTTCATGCACGAGACACA
CTCCAGGAGTGCAGGACATGGCATGCGATACATTCCTGAAAATTGTGCAAAAGTGCAAAA
GAAAATTTGTGATACTTCAGGTTGGTGAAACAGAACCGTTTGTAATGGAGCTTTTAAAGG
GCATCTCATCGACCATAATGGATTTGGAAAATCACCAGATACATTCTTTTTATGAAGCAG
TTGGCTTCATGATTCAAGCTGAAGGAGATCCTCACAAGCGAGATGAGTACCTGCAGAAGC
TTATGGAGCTTCCAAATCAGCGTTGGACAGAAATAATTGGACAAGCTAGGCAGAGCGTAG
ATTACCTATAAGATCATGAGGTTATCAGGACTGTTCTTAATATTTTACAGACACATACTA
GTGTTGCAAGCTCACTTGGGCAACCCTTCCTTTCCCAGATCTCCCTCATATACCTTGACA
TGCTTAATGTGTACAGAATGTACAGTGAGCTTATATCAAGTAACATA