CL2639Contig1
Contig ID CL2639Contig1
Length 624
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2639contig1 sequence.
Clone ID BP919506 BP920099
Sequence
TAAAACAAAACCGATCAAATCTGGACTTGCTAGCTCAGTTAAACTGTTCTTCCTAGACCA
ATTCCATTGGAGCTAACTCCTTCTGAAAGAACATTAGTTGGTATAACTGGGAGGAAACTA
ATCCAAAAGCTGAAAAGCCATGTCCTCCAAACAAATCTACTTCCCCACTCCAAGAATCTC
TTGCTCCAACTCTTGCAATTGTCGATATGGTCTCGCATGGATATTTGCTTGGTATCGAGG
GCCCTGAACTACACCTCCAAAGCAACCTGCTTCATGGGAGACACTCGATCATATCGAGAG
GCAAGTCAATTGTAAATCCTCTTAGCAACTTTCAACAACGCAACGCAATACTCGAGGATG
TAAAACGACTGAATCTAAGCATTGGCACGACCCCACTTCGCTCCAACGAGATCTAACGGT
CTCTTGAACCCATGGGTAACAAAGCATCAAACCACATATCAGCCAAAGACCACAGTCATG
GTTGCACCCAAAATAGCATAATTTGTTGCTAATCAATTGCAAATCCGTCGAGAATGTGGT
TAGAGTAGGTGTTGCTAAATTAACTATTTTCTTATTTTCTCAATAATTTGCATTTGTGCA
CAAGAGAGTTGTTCAGTAACCAGT