CL2695Contig1
Contig ID CL2695Contig1
Length 536
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2695contig1 sequence.
Clone ID BP917213 BP917409
Sequence
CTGGCACAGGAGGAGACGTCAAATGAAAATCAAGGCAAAATTGTGCTGACAGAGGAACTT
GGTGCTTTTCAACATTTGCCTATGGTTGTTTGCTCGAGAGAACTACTTGGATCTGCTCTC
AGGAAAGCAAGGAACATTGGACCTACAAAAGGCATATGTAATATTGCTAAAAGGGAACGA
AACAAGGGTGCCAAGCAACTGGATACTTTGACCAAGGAACTTGCACTTCCTCTGAGGGTT
TATATTGAGAAGTTTCCAAGAAACCAGCACTTACATGCATATGAATATTCTCTTATCGAT
CTAACATTTGGAACGGGCAAGTACGAAGAGGTTCTGGAGAATGTGAACACATTTCGAAAA
AAGATTCTGGATCGTTGGAAAGAATTATGCATTTCTATGTGCAAAGTCAACTTCAAAGCG
TGGGGCTGAGGAGGTTCTGAAAGAAGGATTTTCCAAGCTTGAAGAGCATTTTCGAAAAAA
TGGAGGGGTGGTTGATGAACTTGTGAGTGTTGCAAAGGTTCTTAGAGCAATGCCAG