CL2824Contig1
Contig ID CL2824Contig1
Length 882
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2824contig1 sequence.
Clone ID BP919107 DK951335
Sequence
TGAAGTTTTTAGCGACGCTCTTGAATGTTCTCTCGATAGACCCATCCTTACGTTGATCGA
GTACAGATATCAGTTCCCTAATTTTCTCATCTCCTGCATCCAGCTCAGCCTGCCGCTTGT
GTAGCTCCTCCCTCTGCTCCGTGAAGTTCACGTACTGGTCTAGAGCCTTCTTATTGACGT
GACTGTACTTCTTTAACTGCTCATTGCAGTTATGAAGCATCTTATGCAACTCTTTCAGAC
TCTTTTTTTGGTACTTTTCAAAGGCATCAGATGGTAAAGATCCCAAATCTCTAATTTTCT
TCATGATATCTTCGCGCTTCACTTGAAGAAGGTTTCTCCTATTCAACAGCTGTTCTAGAT
CCTTCTTTTCATCTTGAAGTGTCTTCTCATACTTTTCTTCCAGAACCTTCGTTTCATCTT
TGGATGCCTTCATTTCATTTGTCTGTTTTGTCAATTTATCGATTTGATCAACAATAGTCT
TTAACTGTCTTGTTGCCTCATCCACAGCAACCTTCGCACTTCGCAGCTCCTCGTGCTTTT
TTTCAAGGTCTGTCCTCAGAGCTTCTGGATCAATGGTTGCCAGCTGTGCCTCAAGCTCTT
GTTGCCGCTTCACTAAGTTCGTTGACAAAGCAGCTTCAAGCTCACTTTTTCTAGTTTCCG
CCTCCATTCTTGCAGTCTTGCACTTGACCAACTTTTCCTTCAGTTTCATTATTTCGGGAT
TCAAAGAAGAAAGGAGAGCTTTCTCCTCAGGAGTCAAATGGTCAATAAGGTCAGTACCCA
ACTCTGCTTCCTTAGTTTTAAGAGAGGACTCCAGCTGCTGAATCTGATGATGAGCATTCG
CTAGCAGTTTTCTCTTTTTTTCAAGTGCTTTACTTATAAATG