CL2865Contig1
Contig ID CL2865Contig1
Length 461
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2865contig1 sequence.
Clone ID BP917986 BP919345
Sequence
GGTACTCGACACGAACAACGAAATAATGAAGCTCCACTTCTAGAAGCATTTGGCCCAAAG
TCTAGCGCCCCTTTCAGTACTTCTTTTTATACTAAATAATCCACAAAGTGAAACTGCATT
GGGATCACTTTGCCGATATGCAACCATGCACTGATCTGACCTACTTGACCCCCAAGGCTC
ATGTTCACAGACAATGAAGCCCCAAAAGCAACTACTCCAAAAGCTATGTGCCCTCCAAAA
CTCCCAGCTAAAAATCTGATGCACAAAATCCAGCTCCAGAAAAGCAACACCATGTCATCA
TTGTACAACTGCCATGTCAGCATTGCGCACAGCCTAGCACATCAGCAATCATACGGCCTA
TGATTTGCACCACATATTCCGAGAGATTTTGGATCTTCTAATGGAATGTCAACACGTCAT
CACATTGATAGTCACACCCCTCCGAGCTCCACAACTCCTAT