CL2871Contig1
Contig ID CL2871Contig1
Length 413
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2871contig1 sequence.
Clone ID BP917834 BP920994
Sequence
ATGATATGTTACATATTTTGCCTCATGGCTTTTGCCACCGACATCAAATGATATTTACAT
GTTAACCAATACTGTACACTATACGGTACACTTGGAACCCTTCCCTACAAGAATAACCAA
AAAAAAATGTTTTGGCTTCTTCTAGCGCTTCATTACACAAGCCCCAACGACTTGCCTATG
CACAAGAGCATAAGATCCAGCTCATACTCAGCTTCTCTTACCTATTGAGTGTGCCTCCAG
AGAAGATATTTCTCATTGAAAGGCTCAAACCTTATAGCCTAGAAGATACCCAGTTGATGC
TCCGCTGCGAGCACACAAGAATCCTGCTCTATAACTGAGCTTGCACTGGAGAAGACACTT
TTGTTAGGACCACCACCATCCCCTGGGGTGCATTGCACATCTGGAACAATGCC