CL2895Contig1
Contig ID CL2895Contig1
Length 748
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2895contig1 sequence.
Clone ID BP913903 BP920392
Sequence
TTGTGTTTAGCTGTAAAGTATTAGAATTCCATAACCAGCAATACTTAATCTTCTTTACAA
GTGAATTACTTAAACTAAGGCTGCTGTTTTAAGGTACTGCAATTTGTCTTCATGGTTATG
CTATCAATCAACATGGCAAAAGAATCAAGTGATCTTATAAAAGCCCAAGCACCCCTGAAT
TACGAAAGGGGTCATGGATTAACTACATACTATGATAGTGTGCAGTAAAAATATTAATAT
GATACATGTACACAAGCTTCATGAGCAGGTTTGCAGGTGCAATTTTCTCTAACACCATCA
GGGCCATTTACCTTCAACATCACCGAGTATTACCTGTGATCTTCGTCTTGTGAGGACTGA
CAATTACGGTGTCCAACTGTTGGCAAGCAACAATGGTCTTCACATGCTCAAATTCATCCC
CTGCTATAGCACTAAAGACATCATAAAGACTGTTAATCTTAGGCCGCCGTGTTTCTGGTA
GGCGACTACTCTGGAACTCATCATACATGTAAAGATCTTCGCTTTCATAATAATCCACAG
CTACTGGTGGTGGAGGGAGAGTCTTGAGAAGCTTTTCATTTTCATCAGCAAACTGACCAT
AGGTATCCACTGCATGCATTTCAATCAGCTCTGACAAGTTGTAAGCCACTTATGGGGAAA
TCAGAAACATCAGATTCAGTATCCAATAATAGAAAAACGCTGCATGCTGACCAAAGAATC
GGTCACGCCACTCTAGGTCACCTCCGAG