CL2978Contig1
Contig ID CL2978Contig1
Length 553
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2978contig1 sequence.
Clone ID BP916661 BP916719
Sequence
CTGGAAGGGCCGCAGGGGAAAGTGCACTGCAAAAAACAGCACCTTACGAAGCACCAATAT
TGAAACAAAGTAAATAAATGTGAGGCTCCAGGAATAGAGAAGAAAACAACAAAAATGAGT
TCCCCTGACTGCTGTCTAAATCATCGTAACTATTTATCTTGAGGCTTCACGACATGGAAG
GAGCCTCACATGCCAAACATTTACCTTCTCCTCACTTCAAAGGCATCAAAGACAAAAGAA
ACTTGTAAGCCATTCTGCTGAGCAGAGCCCGCCTTGAGGTTCTTCAACCAAAAACAATCA
AAAAACACAATGCAGAGAAGTAAGAGGAGTGCACAATGGGGGACATGACTATACGAGCTG
GTAGAGTGCCATGCAGTGCCGATGTAGACAGGTCCAACAAGTTTTTCTGTGCCACAAACT
TGAACCTCATGTATGACACCTACACTAATTTTCACCTTATTTCGAAGAAATACCTTAGGT
ACGGAAGGTATCTTGCCACGGCAAGCTTTACTAAGATCTTTGCAAAGATAATTTGATAGC
TCATCCACAGATA