CL3165Contig1
Contig ID CL3165Contig1
Length 544
Number of clones 2
Definition Adiantum capillus-veneris contig: CL3165contig1 sequence.
Clone ID BP913028 BP913698
Sequence
GGGCAAGATAATAGGAGGCCGAGGAAACAGCCCTCTACCTCAACACAACAAGACAAGGAT
GAGGCATCCAACAGAGGACAACATGAAGTTTGAGCAACCAAGAGAACAGGAGGCCGAGGA
AACACCCTCTACCTCAACACAACAAGACAAGGTTAAGGCATCCACGAAGCCTCAGGATAA
CAAGTAAAAGAGGATCAACCACAACCACAATGGCAACACCAACGAGCCGCCATGACACCG
CCAAAAGATACACAAGCAATTTTGCAGAAACATCAAAGCAACTAACACAGAATGAAGATT
GGTAATTAAACGACGAAGTGATCCTGCAAGTTAACGAGTATGCCAAACAAATGCACGACA
TGATTGAACGACTTAGTTGTAGCACAAGGGCCAAAGAATTAGAAATGACGATTGACGCAC
TCCAAGGGGAGTTAGACGACCGACTAAACGTCATCAGTGACCTACAAAGGCAAATGCTTG
AAAGCGGAAGCTGAACAACATTAGCTCGCAAGGGATAGACAACAGGAGTACCTGCAGGTA
ATAT