CL3370Contig1
Contig ID CL3370Contig1
Length 752
Number of clones 2
Definition Adiantum capillus-veneris contig: CL3370contig1 sequence.
Clone ID DK953828 DK960971
Sequence
CGTAGGTCGATGGCAGGAGCAGCTTTCTCTCGGAGTAGGATCTCACTTGCTAGCCTCATT
CAGAAGCTACCATCTCTTGCACCAGATGTAACTGATGGGACGGCTGGAGGTTTTGGCTTC
TTGTTTAGAAGATGGGCAACAAAAAAAGCAGGAGGCTCCACACAAAATGGCAGAGATTCG
AAGCCCAAAAACCTTGGTGTGAAGAAATTTGGTGGTCAGAAAGTTATCGCCGGAAACATC
ATAATCCGACAGCGAGGAACGCGGTTCCATCCAGGAAACTATGTTGGAATGGGTAGGGAC
CACACACTCTTTGCACTGCAGCCAGGTCATGTACGGTTTGAGAAGAACAGGAAAACTGGT
CGCAAATGGGTACATGTGGACCCGGATGAGGGACCAAGAATCCATCCAGTGTATCAGAAT
CTGCCAGCAGAATTTCTGCTGACTAATAACCAAAAACCCAAGACTAAACAAGTTGAGACT
TAATCCTCCTTGGAAGCTATGCGCAAGGTACAGCAAAGCCAGCATGGGTTCATGAGCAAG
AGCTTCTAGCCGAAATGGAAGTAAGGTCAGTCTCCCATCTGTAGGGTTGAGTATATGAGC
AAATAACATTGCTGTGGTAAAATGTTCTCAGCATCGGAGTCTCTTAATGGAGGTTTCAAG
ACTACTTATGGTTGGCGTTTGTGAAGTAGATATTATCTGCGTTGTCGCATTTTGTCACAT
TACCATTTTACGGGAATTTGCAGTTTCTTACT