CL3745Contig1
Contig ID CL3745Contig1
Length 576
Number of clones 2
Definition Adiantum capillus-veneris contig: CL3745contig1 sequence.
Clone ID BP919475 BP918404
Sequence
TATCCAACAGGACCGGTCGACCATACAACAACCACACAAGGCATCTCATTCACAAAGGTT
GAAACAAAAGAACTAAACCTTGAAGAACTTTTTAAAAGTTTGTGAAACAGACCTTATGAC
ATTGCCAATAGCAGCTGGAACATACATTAGAAAATCATCATTATGCTTCCAGCCATCATA
TAACTGCAAGCCTTTTTCCTTCACACTCCCTTTCTCTTCTGTCTCAGGGCTGCCCGTTGC
AGGTCTTTCAAGGGTTTCAGCTCCCTTTGCTTCACCTGACTCACCAAATCCCATACCTGC
TGTTCTTTCCTCAGTAGCTGAAGTTCTTTTCACTACCATGTCTGCGCAGCCATCATCCTC
CTTGATAGAGCTTAACTCGTCATTTGTGCCCTGCGCTGGTTGGGACAAACCACACTGTTC
TGCTCCATTATATTCTGGCTCTTCATTAACTGATCCTACATCATTCCCAGAAGGCGATTG
CCCAATTACTGTCTCTTTCAATCTATTCCTAGGATTCTCCTCGTGTGGCATATCCACTGC
CTGGAATGCATGATACGATAGAGAGTGACTGCCCTC