CL760Contig1
Contig ID CL760Contig1
Length 1408
Number of clones 4
Definition Adiantum capillus-veneris contig: CL760contig1 sequence.
Clone ID BP917868 BP912637 DK960022 DK949610
Sequence
ACGACAGTGTGTGAAAGGATTGTCTTGAACTGCGAGATAAGGATTAAGCCTGATCCTGCT
AATGGGACCGTCACTATAATGGATACTGGAGTGGGGATGACCAAGCAGGATTTGATTGAT
AGTTTGGGAACGATTGCTCAAAGTGGTACAGCCAAGTGTGTGAAGGCACTGAAGGACAAC
AAAGAGGCCCTGGGTGACAATAATTTGATTGGCCAATTTGGGGTCGGATTTTACTCAGCG
TTTTTGGTTGCTGAAAAGGTGGTAGTCTCAACAAAAAGTCCCAAATCAGACAGGCAGTTT
GTGTGGGAGGGAGAAGCAGATAGTAGCTCATATATTATCAGAGAGGAGGTTGATCCCGAG
AAGCTTCTGCCACGAGGCACCTCTATAACATTATATCTGAAGCCTGATGAGGCTTTTGAA
TATTCTGACCCGGTACGCATCAAAGAACTCGTCAAAAGCTACTCCCAGTTTATTTCATTT
CCAATCCATGTATGGATGGAAAAAACTCGAACAGTACCGGATTCGTCTGATTCAACTGAC
ACAGATGACACCAGCACTGAGTCGAAGGAGCAGGAGATGAAAACAAAGACTGAGAAATAT
CATGAGTGGGAGCTTGTCAATGAAACCAAACCAATTTGGATGCGAATCCCGAAAGAAGTG
GAAAAGAACGAGTATGATGCCTTCTACAAGAGTACCTTCAATGAGTACCTAGACCCACTG
GCATACACACATTTTACAACAGAGGGTGAAGTGGAGTTTAGGAGTTTGCTGTACATCCCA
GGAATGGCGCCATTCAATGCTGAGGAGTTGTATACTGCCAATAACAAAAATATACGGTTA
TATGTGAAACGTGTATTTATATCTGCCGATTTTGACGGGGAATTGCTTCCTCGCTATCTT
GGGTTTGTGAAAGGTGTTGTCGATTCAAACGACCTTCCCTTAAATGTATCAAGAGAGATA
CTTCAAGAGAGCCGAATTGTGAGAATCATGAAAAAGAGGCTTGTCCGAAAAATCTTTGAT
ATGTGTCAAGAAATTGCTGACAGAGAAGACAAGGAGGCTTACAAGTCCTTCTGGACCAAT
TTTGGTCGGAGTATAAAGCTGGGTTGTATCGAGGATTCTGCAAATCATAAGCGGCTGACT
CCACTTCTACGATTTTTCACCTCAAAGCACGAAGATAGTCTAGTCAGTCTGAAAACGTAT
GTCGAAGACATGAAGCCAGAGCAAAATGCCATTTATTACTTCGCAGCTGACAGTATCAAA
AGTGCTAAAAGCGCTCCTTTTCTTGAGGCACTTTTGAAAAAAGATTATGAGGTGCTGTTC
CTGATTGAACCCATTGATGAAGTGGCCATCACAAATCTTCAAGAGTATGAGGGAAAGAAG
TTCGTTGATATTAGCAAAGAGGACTTGG