AV404246
Accession Number AV404246
Clone Name pg--0747
Length 701
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 91 %/130 aa
NR definition ref|ZP_06118881.2| DNA packaging protein FI [Clostridium hathewayi DSM 13479] gb|EFC94454.1| DNA packaging protein FI [Clostridium hathewayi DSM 13479]
Drosophila blast_date 10/08/28
Drosophila value n.h
Drosophila definition -
C.elegans blast_date 10/08/27
C.elegans value n.h
C.elegans definition -
Anopheles blast_date 10/09/10
Anopheles value n.h
Anopheles definition -
Apis blast_date 10/09/10
Apis value n.h
Apis definition -
Tribolium blast_date 10/09/10
Tribolium value n.h
Tribolium definition -
Cluster Size 9
Rep ID AV404434
cDNA library name pg--
Sequence
ATTTTCCTCACCGATGGTCAGCGTGTCTCCACGCCGCAGCTGCCGCACCTCATCAGTCCG
GACAAACAGGGACGGGCTGGAGCCTTCAACGCGCACGCCCTGTCCGGCATAGCTGATATT
TTCAGGGTCATCAAAAACACCACGTATCACCGCACCTGACTGCTCACCGGATGTAATGGT
GGCTGACGTTCCCATGTACCCGCGTATCGTTTCATCGGCGCGGGCAATGGCAGCATCGAA
CAGGTTATCGAAATCAGCCACAGCGCCTCCCGTTATTGCATTCTGGCCAGGCCGCGCTCT
GTCATTTCGGCTGCCACACCGGCAGAGACACGAAACGCCGTTCCCGGCAGCACAAATGCC
ACAGGTTCATCCCGCGTGGCGTGAAGTGCATCAGTATGCAGCTTCACCAGTGCCACGACC
GTGACCAGTTCAGACGTATCCAGAATCACGGTATCCGGCTGCGCTGATCCCACCTCATTT
TCATGTCCGGTCAGCACATTTTCCCGGCTGAGAGGGGTGTCCTGACCGGCAGTTTCATCC
GTGTCATCAAGCTCCTCTTTCAGCTCTGCCACACGGAGCGCCAGTTCTTCTTTCGTCCCC
GTCAAGCTGACATCACGGTTCAGTTGTTCACCCAGCGAGCGGAGACGGGCAATCAGTTCA
TCTTTTCGTCATGGACTCCTCCACAGAGAAACAATGGCCCC