BP126151
Accession Number BP126151
Clone Name ps4M0084
Length 825
GO check_date -
GO Iprscan Value
GO ID -
NR blast_date 10/09/28
NR value 52 %/232 aa
NR definition ref|XP_001659582.1| xaa-pro dipeptidase pepd/pepq(e.coli) [Aedes aegypti] gb|EAT39285.1| xaa-pro dipeptidase pepd/pepq(e.coli) [Aedes aegypti]
Drosophila blast_date 10/08/29
Drosophila value 50 %/236 aa
Drosophila definition FBpp0120238|Dana\GF17046-PA
C.elegans blast_date 10/08/28
C.elegans value 40 %/239 aa
C.elegans definition K12C11.1#CE26819#WBGene00019673#status:Confirmed#UniProt:O44995#pro tein_id:AAK18972.1
Anopheles blast_date 10/09/10
Anopheles value 52 %/222 aa
Anopheles definition AGAP004775-PB Protein|2L:3401188:3415683:-1|gene:AGAP004775
Apis blast_date 10/09/10
Apis value 54 %/106 aa
Apis definition gnl|Amel|GB12396-PA
Tribolium blast_date 10/09/10
Tribolium value 52 %/213 aa
Tribolium definition gi|189233738|ref|XP_971576.2| PREDICTED: similar to xaa-pro dipeptidase pepd/pepq(e.coli) [Tribolium castaneum]
Cluster Size 39
Rep ID FS768084
cDNA library name ps4M
Sequence
CTCGTGCCGACATTCGGCACGAGCAGATTAGCAAATAAACTCAAAAGTGGACAAATAGTG
GTTTTGCAAGGAGGTGAAGATGTGAACCACTATGATACTGATGTACAATATGTATTTAGA
CAGGAAGCCTATTTTACATGGGTTTGTGGCGTTAGAGAACCCGGTTGTTATTTTGCCCTA
GATGTTAGTACAGGCAAGTCTTACCTCTTTGTGCCCAGACTTCCTGAGGAGTATGAAGTC
TGGATGGGCAAACTCCATGCCTGTAGTGACTTCAAAAACATATATGCAGTTGATGAAGTC
TATTATGTTGATGAGATAAAAGATGTACTCAAAAGTTTGATGCCGGAAACATTGCTGACA
TTGTCTGGCCCAAACACAGACAGTGGCTTGACGGCCCGAGAAGCCATTTTTAATGGAATT
GATGAGTTCAATGTGGATAATGAATCCTTATTTCCCATTATCGCAGAATTGCGCGTTATC
AAAACGCCAGAGGAAATTGCTGTAATGCGATATGTATGCAAAGTCTCATCTGACGCACAC
AAACAGGTGATGTTGTACGCGAANCAGGTCGAATGGAATACCAATGCGAGTCTATATTTC
TGGATCATTGTTACCGTGTTGGGCGGGTGCCGACATGTTTCGTACACTTGNCATATGCGG
ATCNGGGCACAACGCCGCGACACTTTCACTACGGGCCACGCCGGGACTCCTTAACAGCCA
GATTTATCGTAAACGGCGACATATNGTTATTCGACATTGGGCGGCAACTAACGCCGGCTA
NGNCGCCCGACANTCAACCTGGCTCTTTTCCCGGCTTAACGGGGA