| TEF1BOXATA1 | |
| Identifier | TEF1BOXATA1 |
| Accession number | S000311 |
| Date (operation) author | 7-Sep-2000 (last modified) seki |
| Description | "tef1 box" found in the Arabidopsis (A.t.) EF-1 alpha A1 gene promoter; Conserved in the A.t. EF-1 alpha gene promoters; Involved in the activation of EF-1 alpha gene; Involved in the transcriptional activation of plant genes that are overexpressed in cycling cells; Conserved in the promoters of genes for products related to the translational apparatus; |
| Keywords | EF-1alpha; A1; tef1 box; |
| Species | Arabidopsis (Arabidopsis thaliana) |
| Sequence | ACAGGGGCATAATGGTAATTTAAA |
| Reference | references |