CL1138Contig1
Contig ID CL1138Contig1
Length 953
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1138contig1 sequence.
Clone ID DK960265 DK959596 DK962322
Sequence
GTAGTGTAAGATGGCTTGCAATGGTGACTTCAATATCTCTTCATATATCTTGCCAACAGA
GACCAGCGTAATTGCTTGAGCCTCAATATCCAAACCTTTTGCATTCGTCTCCGCCTCCTT
GTACATATCAATGGCCCCTAGAGCATAGTCAATTTTCTGAGACGGTGTTGCTGCCTCGCT
TGCTTGTTTTGCAAACTTTGCTCCAGCTCTAATGGATTGAATGCACTCGCAGAAACGCTG
GCCGACAGAGATGCGATCTCGCAACAGCTCAAGGACAGGATTTTGCAAGGACGCAGTGGC
CTGCTCTGCAACATGGAGAAGAGAAACACATCTGTGGAAATCCTGGGTGCACTCTTCTAT
GCACGAAGATGGAGAGGTGCGAAGGCTCTCTGATGCGACATCAACAAGGCAAGAAGCTTG
GCCTATGTAGGCTACAACGAGGGCATCACGAGGGGCGTGCGGTGCAAGCTTCGACAAGGC
ACCACAGAGACCAACAAGCGTTTCGAATGCATCCGATTTGCAGAGCTTCTGCTTGTTAGA
TCCGCAGCGAGAGGCGACAGCAGATGCATCTGCAACGACACGGGATGCGATGTCAGAGAG
TTGGGTTTCGATGAAGACGACCCAAGAAGGGGGGCTCCTGGCGAGGAAACCATGGCTGAG
GGCTTCACAGAAGTAGGAAGAGCTGCGGGAGAGGTAGAAGGAGGGGTTGATGTGAGGATC
CGAAGAGGCGAGGCTTGCGAGCTGAAGATGGGTGGCGCCAAGGTTCTTGCAAGCGGCCGC
TTTCTGAGCAGAAGAGATGGAGGCCTCCAGAGCTCGCAGGTAAAGAGCTCGCGCTGCCTG
AAGCTTGGAAATGCGAACGCAGGGCGCAAGCTTTTTCTCCTGCGAGATCCCCTCCTCGTA
ACACACGTTCCCTTTCTGTCTTAGCTCTTCTGCACTCTCCATTTGGACTCGAG