CL1154Contig1
Contig ID CL1154Contig1
Length 540
Number of clones 3
Definition Adiantum capillus-veneris contig: CL1154contig1 sequence.
Clone ID BP912509 BP911730 DK945302
Sequence
ACCCAGTATTTTGGAGCTTTTGATCAAGACGGGAAGTTGGTTGCGGGTGATCCATTGAAA
CAGATCTCAGTGGAGGACATCTGGGTTTTTGAGACTTTTCTTGGCTCACCTCAAAAGAAA
TTTCGGCTCTGTGGACGCATCACATTATAAGCCATTGAATCTCTGGTCTCTATTGCCCTA
AAGGTCTCTCAGGATCCCAGTTAAAGAGCGATTTGCCTTGCTCCTTTGAGAGTTCTGGAT
GGCAATTCGGTAGTGCGCTCGCTGATGCCATCTTTAAGTTGGAGACAAAGGGGAGATCAA
ATTGTACAGAAATTTTTGTTAGTGAAGTTGAGATTTTATGGGTGACTGTAATTGCATGTT
GCAAGACTTCTGATCACTGGGATTGTTAGGAATGGAGTGTAAAAACCTTATATGCGTATT
CTAGCTTTTTGTGAGCTTCATTAAGAGAGTAAAAGCTGTTCAGAATGCCTTGTGTGCAGA
CATGATTGTAACCCTCTGGGTGTTTGATCAATCAATAGAAGGATGTTGGGGAATAGACGT