CL1905Contig1
Contig ID CL1905Contig1
Length 521
Number of clones 2
Definition Adiantum capillus-veneris contig: CL1905contig1 sequence.
Clone ID BP919477 BP919758
Sequence
AGAGAGGATCTTCTGTGCTTCCCTTGGCCCTCCCAAGCTGGGATTGGTCTGTGTTTTCAT
CCAATTTTATCGACTCAGTGCGCTCAAGCACCTGTTCTGTATTGACTCGTGCAAGTCTCT
CTGGGTCCACAATCTCTTGCGGGCCTTGATTGGCTGCCTTGTCTCTCTCTTGCCCCTGAC
TGATAAGCTCCCACTCTCCCATTGAAGCTGGGCTTGTTGACTCTTCCTTATTTCCTTCTG
CAGACACCTCTTTCTTCAAATCATCATCTTGCTCCTTCTCGCTCTCTTTTTCAGCACTAC
TATCAATATCTTGTGTTGCGTCACCTAAGGTTCTCTCCACCGCTTGCCGAAAGCCACTCT
CTTTCTTTTGTTTTGGAGGAGTTTCTTTTGCAAATTGAAGCCAAGCATCATCCAGCTTGT
CCTCCACATGGGCAGGCGCAGTTGCAAGTGCAAAGAAAAATCCACCATCATCCACGTCTT
TATCAATGGGGAACTGTGCAAGAATTTCTTGATCCTCATCA