CL2044Contig1
Contig ID CL2044Contig1
Length 590
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2044contig1 sequence.
Clone ID BP912820 BP918947
Sequence
AAAGGATCAGCAATGATTGATATCACAGCAATAACCCTTTGGCCAGGAGAATGCAATACC
AGTTGTCGTTTTCAACTTAAATGAACCTGGAAACATGTCCAAGGCTGTAAGTGGAGAACG
GATAGGCACCCTTATTGATCAGACGGGGCCTGCACCTTTATATTAATGAAATTAATTATT
TCTAGTTTCCTGGAATAGATGGGGCCCAAATAACGGCTGCATTTCAAATCCAAAGCATGC
CAACCTTGGTAAAGCGGACGTTGCAGCAAGATGTATACTACATCTATTGGCATTTGCCAT
GAATTGGTCTGTGCTCGTGGCTCTTCACGCCGGCCTCAGTTTTGACATAGACGGTTTTGT
ACATAAGATGGGCGAATCAGAGTGGAGTCCTTTGTTCCCCAAGCCTTTCTAATTGTAAGC
ACGTTTATCCATACTCATTGAGACGTTTCCATATAATATTCCGCCTTTGGATGTATGATA
AGTTTCGACGGGCATGTATGCACAGCCAGTTTGGTTATGCACTTTTCCTCGTCGAATGTA
TTGGTACTGGCAAGTCACAAGTACAACCACTTTCCGAAAAAGTCAAGATG