CL2356Contig1
Contig ID CL2356Contig1
Length 709
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2356contig1 sequence.
Clone ID BP913708 DK945863
Sequence
TTGTGATTACAAGCACTGATGACTATCATAAAAAGAGAAAATACCCAAAAACAGAGGTCA
CCCATTGCAGTAGCCCATTTGATTCCTCACCTTTAGAAAGAAAAAACCACAGTGAACATA
CTAGGCACAGACACAAACACTCCATCTCTGGTTGCATATCCCTTGACTCTCTCGCGAATA
TCAATAATAAAGCTCTGTTTCAAGCACTCGTGCATACAAAATCCTGACAAGGCCTGTAGA
AATCAGCTGCTTGTAAGCACAGAATGACTCGCAAAATGGCTCAACGAAAGAATGAAGTGT
TTCATCTCTAGAGCACTGACAGCATATGAAGAGCATAACGTATGGATCACCGTGACCTTC
AAAACTTTCTAAAGATTCAAGAAACCGCTTTTGCATGCCAAACCAATACCATATCGACTC
TACGAGCTGGTCTCTTCTTGTTCAGCACCTTCTTCTGACTCTTCCTCATCTTTTCCTTCC
TCATCAGTTTCTTCCTCGTCGTCCTCCTCATTGTCTTCTACACTATTTGCACCGTAGCGC
GAATTGAGGTACTCGATGGCTGATTTTGTGAAAATAAACTCCCGCGCTTTCAGAATATTA
AAAGGGTTAAGACTTCGAGGAGTCATGAGCATCAAAGTGCTGAGGTTGCGACTGGACTTT
TGAAGATTTTCAGTGTAATTGGTAGTAAACAGCAAAAAGGATTCAGTGC