CL2485Contig1
Contig ID CL2485Contig1
Length 699
Number of clones 2
Definition Adiantum capillus-veneris contig: CL2485contig1 sequence.
Clone ID BP915867 BP920929
Sequence
CTCCAAAACCAATAGATGAGGCTTGTCTCCTTTCTGCAATGGTCTTTTCCAAGTCAACGA
AAGCACCTCCACAAATGAAAAGAATATCCTTCGTATCTACCTGTATATAATCTCCTCTCG
GATGCTTCCGCACACCTTTTTCTGGGACATTCACAACCGTTCCCTCCAACATCTTTAGCA
GGGCCTGCTGCACACCTTCTCCTGACACATCTCTACTAATGTTTACACTTTCCGCCTTCT
TTGTGATTTTATCCACCTCATCAATGTAAACAATGCCCTGTTGAGCAGCTGGAACGTTAA
ATTCAGCAACCGTAAGCAGTTTGTACAAAATAGACTCCACATCTTCTCCAACATACCCAG
CCTGAGTAAGGGTTGTGGCATCTGCAATAACAAAGGGCACATTAACAAACTTGGCCAACG
TTTTTGCCAGCAAGGTTTTCCCTGAGCCAGTAGGACCCATGAGAAGCACATTACTCTTCT
CTAACTCAACATAGTCACCATCTTCATCCTCTTCATCAAACAAATTTGAACCTAATCCAA
CCCCCCTTTCAGCCTTGAAATTTCCCTTTGACAAAGACTCATAATAAATACGTTTATAAT
GATTGTACACAGCAACTGATAAGACCTTTTTTGCGCGGTCCTGTCCAATTACAAATTTGT
CAAGAGCCGTGCGAATCTCCTTCGGAGTGGGAAGATCTT